Stem-loop sequence mes-MIR160f

AccessionMI0024226 (change log)
DescriptionManihot esculenta miR160f stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160f
(23 sentences)

Stem-loop
   u  uu     c         ga      uc  a    c       ag 
5'  ug  ccugc uggcucccu  augcca  ua gaag uugucaa  g
    ||  ||||| |||||||||  ||||||  || |||| |||||||   
3'  ac  ggacg acugagggg  uacggu  au cuuc aacgguu  a
   a  uc     u         ag      uc  c    c       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold02255: 67959-68054 [+]
intergenic
Database links

Mature sequence mes-miR160f

Accession MIMAT0029184
Sequence

8 - 

ugccuggcucccugaaugcca

 - 28

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).