Stem-loop sequence mes-MIR160h

AccessionMI0024228 (change log)
DescriptionManihot esculenta miR160h stem-loop
Gene family MIPF0000032; MIR160
Literature search

7 open access papers mention mes-MIR160h
(20 sentences)

Stem-loop
         c       cu          ug a   c   c  ga 
5' augugc uggcucc  guaugccauu  c gag cca cg  g
   |||||| |||||||  ||||||||||  | ||| ||| ||   
3' uauacg accgagg  uaugcgguag  g cuc ggu gc  a
         u       ag          gu c   c   a  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold12004: 855175-855260 [+]
intergenic
Database links

Mature sequence mes-miR160h

Accession MIMAT0029186
Sequence

4 - 

ugccuggcucccuguaugccauu

 - 26

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).