Stem-loop sequence mes-MIR166g

AccessionMI0024240 (change log)
DescriptionManihot esculenta miR166g stem-loop
Gene family MIPF0000004; MIR166
Literature search

6 open access papers mention mes-MIR166g
(16 sentences)

Stem-loop
   u  a        uu      cu   g c        --a    ug     uu      ugaau 
5'  ug ggggaaug  gucugg  cga g cacuaacu   gauc  uaauu  uaucuc     u
    || ||||||||  ||||||  ||| | ||||||||   ||||  |||||  ||||||      
3'  ac ccccuuac  cggacc  gcu c gugauuga   cuag  guuag  auagag     u
   a  c        uu      ag   g a        gua    ua     -u      uuaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold00872: 85496-85620 [-]
intergenic
Database links

Mature sequence mes-miR166g

Accession MIMAT0029198
Sequence

101 - 

ucggaccaggcuucauucccc

 - 121

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).