Stem-loop sequence mes-MIR167h

AccessionMI0024250 (change log)
DescriptionManihot esculenta miR167h stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

5 open access papers mention mes-MIR167h
(20 sentences)

Stem-loop
   u           g        uag   c    cc 
5'  ugaagcugcca caugaucu   cuu ucuu  u
    ||||||||||| ||||||||   ||| ||||  c
3'  acuuugacggu guacuaga   gaa agag  g
   c           -        cua   a    uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold01551: 1197211-1197280 [-]
intergenic
Database links

Mature sequence mes-miR167h

Accession MIMAT0029208
Sequence

2 - 

ugaagcugccagcaugaucuu

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).