Stem-loop sequence mes-MIR169m

AccessionMI0024263 (change log)
DescriptionManihot esculenta miR169m stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

10 open access papers mention mes-MIR169m
(28 sentences)

Stem-loop
        c         ug          guuuuc  g   ga  u  g 
5' gaaug agccaagaa  acuugccgga      gu cuu  gc cc g
   ||||| |||||||||  ||||||||||      || |||  || ||  
3' cuuac ucgguucuu  uggacggccu      ca gaa  ug gg u
        a         gu          --acuu  a   -a  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11232: 343197-343289 [+]
intergenic
Database links

Mature sequence mes-miR169m

Accession MIMAT0029221
Sequence

6 - 

cagccaagaaugacuugccgg

 - 26

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).