Stem-loop sequence mes-MIR169p

AccessionMI0024266 (change log)
DescriptionManihot esculenta miR169p stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169p
(28 sentences)

Stem-loop
   -         a     u     -cu   --     uacu        uggua 
5'  uagccaagg ugacu gccug   ccu  gcuca    aggguugc     u
    ||||||||| ||||| |||||   |||  |||||    ||||||||      
3'  aucgguucc acuga cggac   gga  ugagu    ucccgacg     a
   a         -     -     uuu   ug     ----        ugaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 2236-2331 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169p
mes-MIR169pscaffold05005: 2236-2331 [+]
mes-MIR169rscaffold05005: 6216-6310 [-]
mes-MIR169qscaffold05005: 6485-6593 [-]
mes-MIR169tscaffold05005: 7537-7640 [+]
mes-MIR169sscaffold05005: 11750-11840 [+]
Database links

Mature sequence mes-miR169p

Accession MIMAT0029224
Sequence

1 - 

uagccaaggaugacuugccug

 - 21

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).