Stem-loop sequence mes-MIR169t

AccessionMI0024270 (change log)
DescriptionManihot esculenta miR169t stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

10 open access papers mention mes-MIR169t
(28 sentences)

Stem-loop
              u    u     -au    auucu     g u     g      u 
5' guagccaagga gacu gcccg   ccau     gagag u ucaug guauau a
   ||||||||||| |||| |||||   ||||     ||||| | ||||| |||||| u
3' uaucgguuccu cuga cgggc   ggug     uucuc g aguac uauaua u
              -    -     auc    -----     - c     g      u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold05005: 7537-7640 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR169t
mes-MIR169pscaffold05005: 2236-2331 [+]
mes-MIR169rscaffold05005: 6216-6310 [-]
mes-MIR169qscaffold05005: 6485-6593 [-]
mes-MIR169tscaffold05005: 7537-7640 [+]
mes-MIR169sscaffold05005: 11750-11840 [+]
Database links

Mature sequence mes-miR169t

Accession MIMAT0029228
Sequence

2 - 

uagccaaggaugacuugcccg

 - 22

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).