Stem-loop sequence mes-MIR171e

AccessionMI0024283 (change log)
DescriptionManihot esculenta miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171e
(17 sentences)

Stem-loop
          c          a         c  u  -  -ga      cauu 
5' aggaaag gauauuggug gguucaauc ga ga cg   uuuaca    g
   ||||||| |||||||||| ||||||||| || || ||   ||||||     
3' uucuuuc cuauaaccgc ccgaguuag cu cu gc   aaaugu    a
          a          g         a  -  a  aga      uaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11970: 74033-74131 [+]
intergenic
Database links

Mature sequence mes-miR171e

Accession MIMAT0029241
Sequence

74 - 

uugagccgcgccaauaucacu

 - 94

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).