Stem-loop sequence mes-MIR171h

AccessionMI0024286 (change log)
DescriptionManihot esculenta miR171h stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

7 open access papers mention mes-MIR171h
(16 sentences)

Stem-loop
   u      u  c    u         u       c   --   aaau  c       ua 
5'  ugaaag gc auug gauguuggc cgguuca uca  gac    ua uauguuu  c
    |||||| || |||| ||||||||| ||||||| |||  |||    || |||||||   
3'  acuuuc cg ugau cuauaaccg gccgagu agu  cug    au guacgaa  u
   a      u  -    u         u       u   uu   --gu  u       ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold09683: 88279-88391 [-]
intergenic
Database links

Mature sequence mes-miR171h

Accession MIMAT0029244
Sequence

78 - 

ugauugagccgugccaauauc

 - 98

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).