Stem-loop sequence mes-MIR172f

AccessionMI0024294 (change log)
DescriptionManihot esculenta miR172f stem-loop
Gene family MIPF0000035; MIR172
Literature search

4 open access papers mention mes-MIR172f
(8 sentences)

Stem-loop
   u     a  g                aca  cuu    -c      -ag    gua     uuau       uu 
5'  ugcug ug agcaucaucaagauuc   ca   uauc  agggcu   ugga   gaagu    gguggcu  u
    ||||| || ||||||||||||||||   ||   ||||  ||||||   ||||   |||||    |||||||   
3'  acggc ac ucguaguaguucuaag   gu   auag  ucccgg   accu   cuucg    ucgcugg  c
   a     g  g                --g  ---    uu      caa    -aa     -uuu       uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03293: 1349-1489 [+]
intergenic
Database links

Mature sequence mes-miR172f

Accession MIMAT0029252
Sequence

115 - 

ggaaucuugaugaugcugcag

 - 135

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).