Stem-loop sequence mes-MIR319f

AccessionMI0024300 (change log)
DescriptionManihot esculenta miR319f stem-loop
Gene family MIPF0000010; MIR159
Literature search

7 open access papers mention mes-MIR319f
(24 sentences)

Stem-loop
   u                     ac  a    u  u     c   ----a   g    cu       ca    aau          aaaga 
5'  gggagcuccuuucaguccaau  gg gggc ga cgcag aag     gcu ccau  caugcac  uggc   acuugacauu     a
    |||||||||||||||||||||  || |||| || ||||| |||     ||| ||||  |||||||  ||||   ||||||||||     a
3'  uccucgagggaagucagguua  cc cucg uu guguc uuc     cga ggug  guacgug  accg   ugaauuguaa     u
   u                     -c  a    c  c     -   cucaa   g    ug       -a    guu          aauug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06446: 168758-168933 [-]
intergenic
Database links

Mature sequence mes-miR319f

Accession MIMAT0029258
Sequence

155 - 

auuggacugaagggagcucc

 - 174

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).