Stem-loop sequence mes-MIR393b

AccessionMI0024305 (change log)
DescriptionManihot esculenta miR393b stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mes-MIR393b
(18 sentences)

Stem-loop
     a          ac            c    u     uaagcucuucuucucu 
5' gc acuagaggag  auccaaagggau gcau gaucc                c
   || ||||||||||  |||||||||||| |||| |||||                c
3' cg ugguuuccuc  uagguuucccua cgua cuagg                c
     a          cu            u    -     uuuucuaauuuuaugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08265: 2433536-2433645 [+]
intergenic
Database links

Mature sequence mes-miR393b

Accession MIMAT0029263
Sequence

17 - 

uccaaagggaucgcauugaucc

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).