Stem-loop sequence mes-MIR393c

AccessionMI0024306 (change log)
DescriptionManihot esculenta miR393c stem-loop
Gene family MIPF0000083; MIR393
Literature search

4 open access papers mention mes-MIR393c
(18 sentences)

Stem-loop
   u   u   - -            c             u    ug    ---uuuc  c     --  -  u 
5'  uag gca g gguggagaguuc aaagggaucgcau gauc  auga       ug ugauu  cg uc c
    ||| ||| | |||||||||||| ||||||||||||| ||||  ||||       || |||||  || || a
3'  auc cgu c ccaccuuuuaag uuucccuagcgua cuag  uacu       ac acuaa  gc ag a
   a   u   u a            a             -    gu    uguuuuu  u     uu  u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold11425: 152114-152249 [+]
intergenic
Database links

Mature sequence mes-miR393c

Accession MIMAT0029264
Sequence

20 - 

uccaaagggaucgcauugaucu

 - 41

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).