Stem-loop sequence mes-MIR477h

AccessionMI0024330 (change log)
DescriptionManihot esculenta miR477h stem-loop
Literature search

3 open access papers mention mes-MIR477h
(6 sentences)

Stem-loop
         au                  caa   c       agcca    c      cauucucuuucaug 
5' aaggca  ucgcguuuaacucucccu   ggg uucagcu     acgu ccuuug              a
   ||||||  ||||||||||||||||||   ||| |||||||     |||| ||||||              g
3' uuccgu  agcgcagguugagggggg   ccc aaguuga     ugca ggagac              a
         cc                  cgg   u       aauug    a      acguaguagcgguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold08265: 457959-458101 [-]
intergenic
Database links

Mature sequence mes-miR477h

Accession MIMAT0029288
Sequence

18 - 

acucucccucaagggcuucag

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).