Stem-loop sequence mes-MIR477i

AccessionMI0024331 (change log)
DescriptionManihot esculenta miR477i stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477i
(6 sentences)

Stem-loop
   a     uuuug                ca            ag     ga   a 
5'  aggca     auuguucacucucccu  agggcuuccggc  ugcca  cau u
    |||||     ||||||||||||||||  ||||||||||||  |||||  |||  
3'  ucugu     uaacaggugagagggg  uccuggaggucg  gcggu  gug g
   -     cauua                -c            -a     aa   c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold06716: 23382-23488 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477i
mes-MIR477kscaffold06716: 23178-23352 [+]
mes-MIR477iscaffold06716: 23382-23488 [+]
mes-MIR477ascaffold06716: 23691-23769 [+]
Database links

Mature sequence mes-miR477i

Accession MIMAT0029289
Sequence

19 - 

acucucccucaagggcuuccg

 - 39

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).