Stem-loop sequence mes-MIR477b

AccessionMI0024333 (change log)
DescriptionManihot esculenta miR477b stem-loop
Gene family MIPF0000216; MIR477
Literature search

3 open access papers mention mes-MIR477b
(6 sentences)

Stem-loop
           u g   c   cu      -           -  auguau         ag  c    auccacaaau 
5' caagccau g uug uca  cucccu caagggcuucu gc      gcucuagcu  cu augc          g
   |||||||| | ||| |||  |||||| ||||||||||| ||      |||||||||  || ||||           
3' guucggug c aac agu  ggggga guucucgaaga cg      uggggucga  ga uacg          c
           c g   a   cg      c           u  gaugau         cu  c    auaaaacaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold03175: 114424-114573 [+]
intergenic
Clustered miRNAs
< 10kb from mes-MIR477b
mes-MIR477bscaffold03175: 114424-114573 [+]
mes-MIR477cscaffold03175: 114710-114884 [+]
Database links

Mature sequence mes-miR477b

Accession MIMAT0029291
Sequence

19 - 

cucucccucaagggcuucug

 - 38

Get sequence
Evidence not experimental

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).