Stem-loop sequence mes-MIR530b

AccessionMI0024341 (change log)
DescriptionManihot esculenta miR530b stem-loop
Gene family MIPF0000521; MIR530
Literature search

1 open access papers mention mes-MIR530b
(3 sentences)

Stem-loop
            uu  c                          a     g  ucu       -    aacaaucaagauccuuguuuu 
5' gccaaaaug  gc uuuaucugcauuugcaccugcaccuu cuuuu uu   uuaaaaa uuuc                     u
   |||||||||  || |||||||||||||||||||||||||| ||||| ||   ||||||| ||||                     c
3' ugguuuuac  cg aaguggacgugaauguggacguggag gaaaa aa   aguuuuu aaag                     c
            --  u                          a     g  ccu       c    agacugugagaucuuuacucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Cassava4) Overlapping transcripts
scaffold04182: 393762-393931 [+]
intergenic
Database links

Mature sequence mes-miR530b

Accession MIMAT0029299
Sequence

21 - 

ugcauuugcaccugcaccuua

 - 41

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22388699 "Computational identification of microRNAs and their targets in cassava (Manihot esculenta Crantz.)" Patanun O, Lertpanyasampatha M, Sojikul P, Viboonjun U, Narangajavana J Mol Biotechnol. 53:257-269(2013).
2
PMID:26822616 "High-resolution identification and abundance profiling of cassava (Manihot esculenta Crantz) microRNAs" Khatabi B, Arikit S, Xia R, Winter S, Oumar D, Mongomake K, Meyers BC, Fondong VN BMC Genomics. 17:85(2016).