Stem-loop sequence ipu-mir-203a

AccessionMI0024558 (change log)
DescriptionIctalurus punctatus miR-203a stem-loop
Gene family MIPF0000108; mir-203
Stem-loop
            u    g    a     cua 
5' agugguucu aaca uuca caguu   u
   ||||||||| |||| |||| |||||   c
3' ucaccagga uugu aagu guuaa   u
            u    a    -     aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-203a

Accession MIMAT0029457
Sequence

1 - 

agugguucuuaacaguucaaca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1