Stem-loop sequence ipu-mir-27c

AccessionMI0024606 (change log)
DescriptionIctalurus punctatus miR-27c stem-loop
Gene family MIPF0000036; mir-27
Stem-loop
   --          c   u       a  cauc 
5'   ggacuuaacc acu gugaaca ug    g
     |||||||||| ||| ||||||| ||     
3'   cuugaauugg uga cacuugu ac    a
   gu          -   -       a  uuca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-27c

Accession MIMAT0029489
Sequence

41 - 

uucacagugguuaaguucug

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1