Stem-loop sequence ipu-mir-457a

AccessionMI0024636 (change log)
DescriptionIctalurus punctatus miR-457a stem-loop
Stem-loop
   aag       -uca         gcu    uc 
5'    cagcaca    auauuggca   gccc  u
      |||||||    |||||||||   ||||  c
3'    gucgugu    uaugaccgu   uggg  u
   ---       uugg         ---    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-457a

Accession MIMAT0029515
Sequence

1 - 

aagcagcacaucaauauuggca

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1