Stem-loop sequence mmu-mir-7648

AccessionMI0024986 (change log)
Symbol MGI:Mir7648
DescriptionMus musculus miR-7648 stem-loop
Literature search

1 open access papers mention mmu-mir-7648
(1 sentences)

Stem-loop
                     g  cc     
5' ccgcguuccgggcucggc cu  gggc 
   |||||||||||||||||| ||  ||| u
3' ggcgcagggcccgggucg ga  cccg 
                     g  --     
Get sequence
Deep sequencing
242 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 90224360-90224412 [+]
sense
ENSMUST00000100309 ; Alg10b-201; 3'UTR (exon 1)
Database links

Mature sequence mmu-miR-7648-5p

Accession MIMAT0029798
Sequence

1 - 

ccgcguuccgggcucggcgc

 - 20

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7648-3p

Accession MIMAT0029799
Sequence

33 - 

agggcugggcccgggacgcgg

 - 53

Get sequence
Deep sequencing225 reads, 47 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1