Stem-loop sequence mmu-mir-7654

AccessionMI0024994 (change log)
Symbol MGI:Mir7654
DescriptionMus musculus miR-7654 stem-loop
Stem-loop
   ---g   u                  ------  a  a 
5'     gag cgcgcucccgcucgcgcu      cc cc a
       ||| ||||||||||||||||||      || || c
3'     cuc gcgcgagggcgagcgcgg      gg gg g
   ccug   c                  cccuac  c  c 
Get sequence
Deep sequencing
137 reads, 0 reads per million, 48 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr8: 8690093-8690162 [-]
sense
ENSMUST00000048545 ; Arglu1-201; exon 1
antisense
ENSMUST00000179702 ; B930078G14Rik-201; intron 1
Database links

Mature sequence mmu-miR-7654-5p

Accession MIMAT0029814
Sequence

1 - 

ggagucgcgcucccgcucgcgc

 - 22

Get sequence
Deep sequencing120 reads, 46 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7654-3p

Accession MIMAT0029815
Sequence

49 - 

cgagcgggagcgcgccucgucc

 - 70

Get sequence
Deep sequencing13 reads, 12 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1