Stem-loop sequence mmu-mir-7662

AccessionMI0025002 (change log)
Symbol MGI:Mir7662
DescriptionMus musculus miR-7662 stem-loop
Stem-loop
   --        --g      a      aua     
5'   agggcuga   gccugg uccagc   cugc 
     ||||||||   |||||| ||||||   ||| u
3'   uuccgacu   cggacc aggucg   gacu 
   cg        agg      g      --a     
Get sequence
Deep sequencing
35 reads, 0 reads per million, 20 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 62194167-62194227 [-]
sense
ENSMUST00000047883 ; Tspan15-201; intron 3
Database links

Mature sequence mmu-miR-7662-5p

Accession MIMAT0029830
Sequence

1 - 

agggcugaggccuggauccagc

 - 22

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7662-3p

Accession MIMAT0029831
Sequence

38 - 

uggagccaggcggaucagccuugc

 - 61

Get sequence
Deep sequencing27 reads, 16 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1