Stem-loop sequence mmu-mir-7664

AccessionMI0025004 (change log)
Symbol MGI:Mir7664
DescriptionMus musculus miR-7664 stem-loop
Stem-loop
   --c    u    -     u       aa      
5'    aguu accu gucua gagaugg  guacu 
      |||| |||| ||||| |||||||  |||| u
3'    ucaa uggg cggau cucuauc  uaugg 
   uaa    u    u     u       -c      
Get sequence
Deep sequencing
22 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 25059811-25059873 [+]
sense
OTTMUST00000027159 ; Nelf-009; intron 3
OTTMUST00000027201 ; Nelf-010; intron 6
OTTMUST00000027157 ; Nelf-007; intron 6
OTTMUST00000027155 ; Nelf-005; intron 6
OTTMUST00000027204 ; Nelf-013; intron 6
OTTMUST00000027154 ; Nelf-004; intron 6
OTTMUST00000027156 ; Nelf-006; intron 7
OTTMUST00000027152 ; Nelf-002; intron 7
OTTMUST00000027151 ; Nelf-001; intron 8
OTTMUST00000027153 ; Nelf-003; intron 8
ENSMUST00000134744 ; Nsmf-009; intron 3
ENSMUST00000152122 ; Nsmf-010; intron 6
ENSMUST00000074422 ; Nsmf-007; intron 6
ENSMUST00000114388 ; Nsmf-005; intron 6
ENSMUST00000140737 ; Nsmf-013; intron 6
ENSMUST00000114386 ; Nsmf-004; intron 6
ENSMUST00000006646 ; Nsmf-006; intron 7
ENSMUST00000102931 ; Nsmf-002; intron 7
ENSMUST00000116574 ; Nsmf-201; intron 7
ENSMUST00000100334 ; Nsmf-001; intron 8
ENSMUST00000144520 ; Nsmf-003; intron 8
Database links

Mature sequence mmu-miR-7664-5p

Accession MIMAT0029834
Sequence

1 - 

caguuuaccugucuaugagau

 - 21

Get sequence
Deep sequencing3 reads, 3 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7664-3p

Accession MIMAT0029835
Sequence

41 - 

ucucuuaggcuggguuaacuaau

 - 63

Get sequence
Deep sequencing19 reads, 12 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1