Stem-loop sequence mmu-mir-7667

AccessionMI0025007 (change log)
Symbol MGI:Mir7667
DescriptionMus musculus miR-7667 stem-loop
Stem-loop
   --ga         c   c      uauacuu 
5'     gccaucucu uag cccuga       u
       ||||||||| ||| ||||||       u
3'     cgguagaga guc gggacu       a
   guca         c   a      ucguaua 
Get sequence
Deep sequencing
1649 reads, 116 reads per million, 85 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 29595538-29595600 [+]
sense
OTTMUST00000117455 ; RP24-271E12.4-001; intron 1
OTTMUST00000087479 ; Tbc1d22b-002; intron 4
OTTMUST00000087478 ; Tbc1d22b-001; intron 9
ENSMUST00000150388 ; RP24-271E12.4-001; intron 1
ENSMUST00000160114 ; Tbc1d22b-002; intron 4
ENSMUST00000048677 ; Tbc1d22b-001; intron 9
antisense
OTTMUST00000087476 ; RP24-542G7.2-001; intron 1
OTTMUST00000087477 ; RP24-542G7.2-002; intron 1
ENSMUST00000163069 ; 0610038L08Rik-001; intron 1
ENSMUST00000159875 ; 0610038L08Rik-002; intron 1
Database links

Mature sequence mmu-miR-7667-5p

Accession MIMAT0029840
Sequence

1 - 

gagccaucucucuagccccuga

 - 22

Get sequence
Deep sequencing200 reads, 63 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7667-3p

Accession MIMAT0029841
Sequence

42 - 

agggacugcagagauggcacug

 - 63

Get sequence
Deep sequencing1448 reads, 62 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1