Stem-loop sequence mmu-mir-7668

AccessionMI0025008 (change log)
Symbol MGI:Mir7668
DescriptionMus musculus miR-7668 stem-loop
Stem-loop
   -ca        aa     u  c     aa 
5'    cucugaau  ccugc cu ugugg  g
      ||||||||  ||||| || |||||   
3'    gagacuua  ggacg gg guacc  a
   gag        gg     u  c     aa 
Get sequence
Deep sequencing
561 reads, 0 reads per million, 58 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 29906509-29906567 [+]
antisense
OTTMUST00000072283 ; Zfp27-001; 5'UTR (exon 1)
OTTMUST00000072284 ; Zfp27-002; 5'UTR (exon 1)
ENSMUST00000162592 ; Zfp27-001; 5'UTR (exon 1)
ENSMUST00000159920 ; Zfp27-002; 5'UTR (exon 1)
Database links

Mature sequence mmu-miR-7668-5p

Accession MIMAT0029842
Sequence

1 - 

cacucugaauaaccugcucucugu

 - 24

Get sequence
Deep sequencing73 reads, 28 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7668-3p

Accession MIMAT0029843
Sequence

38 - 

cggugcaggggauucagaggag

 - 59

Get sequence
Deep sequencing486 reads, 55 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1