Stem-loop sequence mmu-mir-7677

AccessionMI0025022 (change log)
Symbol MGI:Mir7677
DescriptionMus musculus miR-7677 stem-loop
Stem-loop
   -agu      c  aaa      gc    u       
5'     ggugag ag   gcagcc  ggug guggca 
       |||||| ||   ||||||  |||| ||||| c
3'     ccacuc uc   ugucgg  ccac cgcugc 
   ggau      -  cug      --    u       
Get sequence
Deep sequencing
27 reads, 0 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr17: 27091245-27091311 [+]
sense
OTTMUST00000077693 ; Itpr3-001; intron 11
ENSMUST00000049308 ; Itpr3-001; intron 11
Database links

Mature sequence mmu-miR-7677-5p

Accession MIMAT0029868
Sequence

1 - 

aguggugagcagaaagcagccgcgg

 - 25

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7677-3p

Accession MIMAT0029869
Sequence

45 - 

ccggcuguguccucucaccuagg

 - 67

Get sequence
Deep sequencing26 reads, 12 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1