Stem-loop sequence mmu-mir-7679

AccessionMI0025024 (change log)
Symbol MGI:Mir7679
DescriptionMus musculus miR-7679 stem-loop
Stem-loop
   --a  c   c   --a      c    -u      
5'    gg ugg acc   ggaucc ugau  ugaga 
      || ||| |||   |||||| ||||  |||| u
3'    cc acc ugg   ccuagg acug  auucu 
   cga  a   a   gac      -    uc      
Get sequence
Deep sequencing
208 reads, 0 reads per million, 43 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 82985003-82985065 [-]
sense
OTTMUST00000001797 ; Slfn9-001; intron 2
OTTMUST00000001799 ; Slfn9-003; intron 2
OTTMUST00000001798 ; Slfn9-002; intron 3
ENSMUST00000038211 ; Slfn9-001; intron 2
ENSMUST00000138797 ; Slfn9-003; intron 2
ENSMUST00000092840 ; Slfn9-002; intron 3
Database links

Mature sequence mmu-miR-7679-5p

Accession MIMAT0029872
Sequence

1 - 

aggcuggcaccaggaucccu

 - 20

Get sequence
Deep sequencing158 reads, 32 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7679-3p

Accession MIMAT0029873
Sequence

40 - 

caggaucccaggguaccaaccagc

 - 63

Get sequence
Deep sequencing50 reads, 29 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1