Stem-loop sequence mmu-mir-7680

AccessionMI0025025 (change log)
Symbol MGI:Mir7680
DescriptionMus musculus miR-7680 stem-loop
Stem-loop
   ---                      gu 
5'    auuccagugaacaagcaguucg  a
      ||||||||||||||||||||||  u
3'    uaaggucacuuguucgucaagc  g
   gga                      ac 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr16: 21256013-21256066 [-]
sense
ENSMUST00000181476 ; Gm16863-201; intron 3
Database links

Mature sequence mmu-miR-7680-5p

Accession MIMAT0029874
Sequence

1 - 

auuccagugaacaagcaguu

 - 20

Get sequence
Deep sequencing11 reads, 8 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7680-3p

Accession MIMAT0029875
Sequence

33 - 

acugcuuguucacuggaauagg

 - 54

Get sequence
Deep sequencing36 reads, 18 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1