Stem-loop sequence mmu-mir-7681

AccessionMI0025029 (change log)
Symbol MGI:Mir7681
DescriptionMus musculus miR-7681 stem-loop
Stem-loop
   --        cu      c     u gcaucagaaa 
5'   auccuguc  ugcccu ucugu g          c
     ||||||||  |||||| ||||| |           
3'   uaggacag  acggga agaca c          c
   ga        uc      a     u acauccacau 
Get sequence
Deep sequencing
474 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 53849424-53849495 [+]
antisense
OTTMUST00000072493 ; Hecw2-003; intron 4
OTTMUST00000072479 ; Hecw2-001; intron 21
ENSMUST00000152870 ; Hecw2-003; intron 4
ENSMUST00000120904 ; Hecw2-001; intron 21
ENSMUST00000087659 ; Hecw2-201; intron 21
Database links

Mature sequence mmu-miR-7681-5p

Accession MIMAT0029882
Sequence

1 - 

auccuguccuugcccucucu

 - 20

Get sequence
Deep sequencing26 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7681-3p

Accession MIMAT0029883
Sequence

51 - 

agaaagggcacugacaggauag

 - 72

Get sequence
Deep sequencing446 reads, 19 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1