Stem-loop sequence mmu-mir-7682

AccessionMI0025030 (change log)
Symbol MGI:Mir7682
DescriptionMus musculus miR-7682 stem-loop
Stem-loop
   -    a      uug      aa  u  g 
5'  aggc cgacuc   ccacag  ac ga u
    |||| ||||||   ||||||  || || g
3'  uucg guuggg   gguguc  ug uu c
   u    -      uug      -c  u  a 
Get sequence
Deep sequencing
517 reads, 3.92 reads per million, 51 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr1: 151442393-151442450 [+]
sense
ENSMUST00000065625 ; Trmt1l-201; intron 5
Database links

Mature sequence mmu-miR-7682-5p

Accession MIMAT0029884
Sequence

1 - 

aggcacgacucuugccacagaaac

 - 24

Get sequence
Deep sequencing8 reads, 7 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7682-3p

Accession MIMAT0029885
Sequence

38 - 

ccuguggguuggguuggcuuu

 - 58

Get sequence
Deep sequencing509 reads, 48 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1