Stem-loop sequence mmu-mir-7684

AccessionMI0025033 (change log)
Symbol MGI:Mir7684
DescriptionMus musculus miR-7684 stem-loop
Literature search

1 open access papers mention mmu-mir-7684
(3 sentences)

Stem-loop
   ucu   -a     g  -       ----g  g 
5'    ggg  agccu gg cagcagu     gg c
      |||  ||||| || |||||||     ||  
3'    ucc  ucggg uc gucgucg     cc a
   gug   gg     g  a       aggua  a 
Get sequence
Deep sequencing
18 reads, 72.7 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 82393919-82393978 [-]
sense
ENSMUST00000170255 ; Cyp2d11-201; 5'UTR (exon 1)
Database links

Mature sequence mmu-miR-7684-5p

Accession MIMAT0029890
Sequence

1 - 

ucugggaagccugggcagcag

 - 21

Get sequence
Deep sequencing5 reads, 5 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7684-3p

Accession MIMAT0029891
Sequence

39 - 

ugcugacuggggcuggccugug

 - 60

Get sequence
Deep sequencing6 reads, 6 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1