Stem-loop sequence mmu-mir-7685

AccessionMI0025036 (change log)
Symbol MGI:Mir7685
DescriptionMus musculus miR-7685 stem-loop
Stem-loop
   -a  uu    uuucu            uc ug 
5'   cc  ccgg     ucaagucuccug  c  c
     ||  ||||     ||||||||||||  |   
3'   gg  ggcc     gguucagaggac  g  a
   ga  uc    --uuc            -c ua 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 23 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 158243504-158243565 [-]
intergenic
Database links

Mature sequence mmu-miR-7685-5p

Accession MIMAT0029896
Sequence

1 - 

accuuccgguuucuucaagucucc

 - 24

Get sequence
Deep sequencing12 reads, 8 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7685-3p

Accession MIMAT0029897
Sequence

42 - 

agacuuggcuuccggcuggag

 - 62

Get sequence
Deep sequencing42 reads, 17 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1