Stem-loop sequence mmu-mir-7686

AccessionMI0025037 (change log)
Symbol MGI:Mir7686
DescriptionMus musculus miR-7686 stem-loop
Literature search

1 open access papers mention mmu-mir-7686
(3 sentences)

Stem-loop
   c   cc  u ga   g    u     cu 
5'  cuu  ac g  ccu gggc gggcg  u
    |||  || |  ||| |||| |||||   
3'  gag  ug c  ggg cucg ucugu  u
   a   aa  u ac   g    -     cc 
Get sequence
Deep sequencing
498 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr7: 139957566-139957622 [-]
sense
OTTMUST00000078514 ; AC107822.6-001; exon 2
ENSMUST00000130771 ; Gm2044-001; exon 2
antisense
OTTMUST00000078515 ; AC107822.5-001; intron 1
OTTMUST00000078516 ; AC107822.5-002; intron 3
ENSMUST00000139218 ; Gm16201-001; intron 1
ENSMUST00000134312 ; Gm16201-002; intron 3
Clustered miRNAs
< 10kb from mmu-mir-7686
mmu-mir-202chr7: 139957689-139957760 [-]
mmu-mir-7686chr7: 139957566-139957622 [-]
Database links

Mature sequence mmu-miR-7686-5p

Accession MIMAT0029898
Sequence

1 - 

ccuuccacuggaccuggggcugggc

 - 25

Get sequence
Deep sequencing56 reads, 16 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7686-3p

Accession MIMAT0029899
Sequence

36 - 

cugcucggggcacuguaagaga

 - 57

Get sequence
Deep sequencing441 reads, 14 experiments
Evidence experimental; RNAseq [1]
Predicted targets

References

1