Stem-loop sequence mmu-mir-7688

AccessionMI0025041 (change log)
Symbol MGI:Mir7688
DescriptionMus musculus miR-7688 stem-loop
Stem-loop
   --u            u  gau     cac 
5'    agcugggcauga cu   gagcu   a
      |||||||||||| ||   |||||    
3'    ucgauccguauu gg   cucgg   g
   cuu            c  --u     acc 
Get sequence
Deep sequencing
1496 reads, 3.57 reads per million, 56 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 93433107-93433162 [+]
intergenic
Database links

Mature sequence mmu-miR-7688-5p

Accession MIMAT0029906
Sequence

1 - 

uagcugggcaugaucugaugagc

 - 23

Get sequence
Deep sequencing1491 reads, 54 experiments
Evidence experimental; RNAseq [1]
Predicted targets

Mature sequence mmu-miR-7688-3p

Accession MIMAT0029907
Sequence

36 - 

ucuggcuuaugccuagcuuuc

 - 56

Get sequence
Evidence experimental; RNAseq [1]
Predicted targets

References

1