Stem-loop sequence mmu-mir-1291

AccessionMI0026023 (change log)
Symbol MGI:Mir1291
DescriptionMus musculus miR-1291 stem-loop
Gene family MIPF0000599; mir-1291
Literature search

4 open access papers mention mmu-mir-1291
(107 sentences)

Stem-loop
   --------a      ag   u  ga    acccau   -   ua  ga              a 
5'          gaauca  gga gg  gguu      ggc ucu  cu  agacuagcaguuau c
            ||||||  ||| ||  ||||      ||| |||  ||  |||||||||||||| a
3'          uuuggu  ccu uc  ucaa      ccg aga  ga  uuugguugucgaug c
   caucgauua      ga   -  ug    -gagau   c   -c  ac              u 
Get sequence
Deep sequencing
1414 reads, 0 reads per million, 82 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr15: 98519762-98519878 [-]
sense
ENSMUST00000083402 ; Snora34-201; exon 1
ENSMUST00000023727 ; Kansl2-201; intron 9
ENSMUST00000116400 ; Kansl2-202; intron 9
Database links

Mature sequence mmu-miR-1291

Accession MIMAT0031397
Sequence

26 - 

auggcucuuacugaagacuagcaguu

 - 51

Get sequence
Deep sequencing1383 reads, 81 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1