Stem-loop sequence sma-mir-125c

AccessionMI0027196 (change log)
DescriptionSchistosoma mansoni miR-125c stem-loop
Literature search

3 open access papers mention sma-mir-125c
(5 sentences)

Stem-loop
   cuugc   --       au     auc     g   u     u    cu     gaa    uuuc 
5'      guu  gcauugu  uccgu   ccuga acc uagag uguc  guuuu   uuau    g
        |||  |||||||  |||||   ||||| ||| ||||| ||||  |||||   ||||    a
3'      caa  cguaaua  aggca   ggacu ugg aucuc acag  uagaa   aaua    u
   uacaa   au       --     -cu     a   c     c    -u     -aa    uuau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 34097074-34097199 [-]
intergenic
Database links

Mature sequence sma-miR-125c-5p

Accession MIMAT0033510
Sequence

24 - 

ucccugagaccuuagaguuguc

 - 45

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-125c-3p

Accession MIMAT0033511
Sequence

85 - 

caccucuacgguaucaggucacg

 - 107

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).