Stem-loop sequence sma-mir-36b

AccessionMI0027198 (change log)
DescriptionSchistosoma mansoni miR-36b stem-loop
Literature search

3 open access papers mention sma-mir-36b
(4 sentences)

Stem-loop
   auaaa    --       -aagg         uu    uu    - ---auc        -        u 
5'      agca  gcaucug     gaaugucug  cggu  gugu c      gugguuac uuguuagg a
        ||||  |||||||     |||||||||  ||||  |||| |      |||||||| |||||||| c
3'      ucgu  uguagac     cuuacagau  gcca  caca g      uaucaaug aauaauuc u
   aaaug    uc       gccua         gg    -c    u acuuuu        u        a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 57514904-57515037 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-36b
sma-mir-8406Chr_1: 57517953-57518106 [-]
sma-mir-36bChr_1: 57514904-57515037 [-]
Database links

Mature sequence sma-miR-36b-5p

Accession MIMAT0033514
Sequence

18 - 

agggaaugucuguucgguuugu

 - 39

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-36b-3p

Accession MIMAT0033515
Sequence

95 - 

ccaccggguagacauucauccgc

 - 117

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).