Stem-loop sequence sma-mir-8406

AccessionMI0027199 (change log)
DescriptionSchistosoma mansoni miR-8406 stem-loop
Stem-loop
   ucaca   -   a -ga      ua       guagc     c    -----    g    u      --a        ag  a 
5'      agu auu u   gcacua  aauaaca     aaaug aucu     agau aaug uuuagu   aauauuuu  ga a
        ||| ||| |   ||||||  |||||||     ||||| ||||     |||| |||| ||||||   ||||||||  ||  
3'      uca uga a   ugugau  uuguugu     uuuau uaga     uuua uuau aaauca   uuauggaa  uu u
   --uua   a   a aug      uc       -----     u    auucu    g    u      aug        cu  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1: 57517953-57518106 [-]
intergenic
Clustered miRNAs
< 10kb from sma-mir-8406
sma-mir-8406Chr_1: 57517953-57518106 [-]
sma-mir-36bChr_1: 57514904-57515037 [-]
Database links

Mature sequence sma-miR-8406-5p

Accession MIMAT0033516
Sequence

35 - 

caaaugcaucuagaugaau

 - 53

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8406-3p

Accession MIMAT0033517
Sequence

107 - 

uuuucuuaagauuuauuuug

 - 126

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).