Stem-loop sequence sma-mir-8447

AccessionMI0027243 (change log)
DescriptionSchistosoma mansoni miR-8447 stem-loop
Literature search

1 open access papers mention sma-mir-8447
(1 sentences)

Stem-loop
   ugacu    ga        gauug     auaugauga     -    -ga    -  u 
5'      gagu  uagagagu     gugca         acacu auca   ucca ac u
        ||||  ||||||||     |||||         ||||| ||||   |||| || u
3'      cuca  auuuuucg     uaugu         uguga uagu   aggu ug g
   uuagu    --        -agca     --------g     g    aac    a  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_5: 4860464-4860570 [+]
intergenic
Database links

Mature sequence sma-miR-8447-5p

Accession MIMAT0033604
Sequence

28 - 

caauaugaugaacacuauca

 - 47

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-8447-3p

Accession MIMAT0033605
Sequence

66 - 

gacaaugaugaguguguguauac

 - 88

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).