Stem-loop sequence sma-mir-124b

AccessionMI0027250 (change log)
DescriptionSchistosoma mansoni miR-124b stem-loop
Literature search

4 open access papers mention sma-mir-124b
(10 sentences)

Stem-loop
   gaagc    -    --ugau     c     --g -   a    ca     --      aauauuuuu           
5'      uaua guga      uaaag uccgu   g aug cauu  ccgcg  ugccuu         guuaugaaua 
        |||| ||||      ||||| |||||   | ||| ||||  |||||  ||||||         ||||||||| a
3'      auau cauu      auuuc aggca   c uac guaa  ggcgc  acggaa         caauauuuau 
   uagua    u    uguaau     -     aaa a   g    aa     ua      ----cuacu           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_6: 18429504-18429647 [+]
intergenic
Clustered miRNAs
< 10kb from sma-mir-124b
sma-mir-124bChr_6: 18429504-18429647 [+]
sma-mir-124aChr_6: 18429525-18429617 [-]
Database links

Mature sequence sma-miR-124b-5p

Accession MIMAT0033618
Sequence

35 - 

cauucaccgcgugccuuaa

 - 53

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-124b-3p

Accession MIMAT0033619
Sequence

84 - 

aucaaggcaaucgcggaaaa

 - 103

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).