Stem-loop sequence sma-mir-755

AccessionMI0027257 (change log)
DescriptionSchistosoma mansoni miR-755 stem-loop
Literature search

1 open access papers mention sma-mir-755
(1 sentences)

Stem-loop
      u  u        u           uu   uu   g     -----------    u  a  c    au     c 
5' guu ug gugguaug acaguuggagu  uug  ucu cacca           acaa au uc cuuu  ugaag u
   ||| || |||||||| |||||||||||  |||  ||| |||||           |||| || || ||||  ||||| a
3' uag gc uaccauau ugucaacuuca  aac  aga guggu           uguu ua ag gaga  gcuuc c
      u  u        -           uc   uu   -     aguaauuauaa    u  -  a    au     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 7590680-7590822 [-]
intergenic
Database links

Mature sequence sma-miR-755-5p

Accession MIMAT0033631
Sequence

20 - 

guuggaguuuuuguuucugcacc

 - 42

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-755-3p

Accession MIMAT0033632
Sequence

106 - 

ugagauucaacuacuucaacu

 - 126

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).