Stem-loop sequence sma-mir-8459

AccessionMI0027258 (change log)
DescriptionSchistosoma mansoni miR-8459 stem-loop
Literature search

1 open access papers mention sma-mir-8459
(1 sentences)

Stem-loop
   cuuua       ---ag   -   ua       ---uaa    g  ua   -guc       ug 
5'      cauugcc     guu uau  cguguaa      cgaa ac  gug    uucagga  a
        |||||||     ||| |||  |||||||      |||| ||  |||    |||||||   
3'      guaacgg     cga aua  gcacauu      gcuu ug  cau    agguucu  a
   gauug       aauaa   c   cg       cuaacg    a  ug   aaua       uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 9705928-9706049 [-]
intergenic
Database links

Mature sequence sma-miR-8459-5p

Accession MIMAT0033633
Sequence

30 - 

uaacgaagacuaguggucuu

 - 49

Get sequence
Evidence experimental; SOLiD [1]

Mature sequence sma-miR-8459-3p

Accession MIMAT0033634
Sequence

63 - 

uuggaauaauacguguauu

 - 81

Get sequence
Evidence experimental; SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).