Stem-loop sequence sma-mir-1b

AccessionMI0027262 (change log)
DescriptionSchistosoma mansoni miR-1b stem-loop
Literature search

3 open access papers mention sma-mir-1b
(7 sentences)

Stem-loop
   uuaua      -   -   uc        -uu          c     gg    a    aauuuaa     --               agaa 
5'      cuuauu gua auu  uucuaguc   ugcauacuuc caaua  ccau gagu       uacuc  uacuaguuuuuuauu    a
        |||||| ||| |||  ||||||||   |||||||||| |||||  |||| ||||       |||||  |||||||||||||||     
3'      gaguaa cgu uga  agggucag   guguaugaag guugu  ggua uuca       augag  augaucaaaaaguaa    a
   -----      a   c   cc        cuc          u     aa    -    -------     uc               gaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_W: 42513103-42513270 [-]
intergenic
Database links

Mature sequence sma-miR-1b-5p

Accession MIMAT0033641
Sequence

32 - 

cauacuucccaauaggccaua

 - 52

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

Mature sequence sma-miR-1b-3p

Accession MIMAT0033642
Sequence

121 - 

uggaauguugugaaguaugugc

 - 142

Get sequence
Evidence experimental; Illumina [1], SOLiD [1]

References

1
PMID:24069470 "Sex-biased expression of microRNAs in Schistosoma mansoni" Marco A, Kozomara A, Hui JH, Emery AM, Rollinson D, Griffiths-Jones S, Ronshaugen M PLoS Negl Trop Dis. 7:e2402(2013).