Stem-loop sequence cfa-mir-3958

AccessionMI0027985 (change log)
DescriptionCanis familiaris miR-3958 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   gagg   ---a   u    acag   cu   c ga    uuc            u     au         uug 
5'     acg    gcg gguc    aag  ggu u  gaug   gaaaggagguug ccgug  guauuugcu   u
       |||    ||| ||||    |||  ||| |  ||||   |||||||||||| |||||  |||||||||    
3'     ugc    cgc ccag    uuc  ccg a  cuac   cuuuucucuagu ggcac  uauagacgg   u
   ----   acgg   -    gaag   uu   u aa    -ua            u     gu         uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69267134-69267274 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-3958
cfa-mir-323chr8: 69257494-69257549 [+]
cfa-mir-758chr8: 69257782-69257862 [+]
cfa-mir-329bchr8: 69258528-69258607 [+]
cfa-mir-329achr8: 69258855-69258914 [+]
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
Database links

Mature sequence cfa-miR-3958

Accession MIMAT0034388
Sequence

79 - 

cagauauugcacgguugaucucu

 - 101

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).