Stem-loop sequence eca-mir-514a

AccessionMI0028357 (change log)
DescriptionEquus caballus miR-514a stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   ----------    u   ca    cu     -    aa             aua 
5'           gcug gug  uuac  cacuc cgga  gugucaaucaugu   a
             |||| |||  ||||  ||||| ||||  |||||||||||||    
3'           cgac cgc  aaug  gugag gucu  cacaguuaguaua   c
   caacguauau    -   --    ag     u    -c             aau 
Get sequence
Deep sequencing
4923 reads, 200 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 116750733-116750827 [-]
sense
Clustered miRNAs
< 10kb from eca-mir-514a
eca-mir-507achrX: 116755935-116756029 [-]
eca-mir-506achrX: 116755599-116755743 [-]
eca-mir-514achrX: 116750733-116750827 [-]
Database links

Mature sequence eca-miR-514a

Accession MIMAT0034715
Sequence

16 - 

ucacuccggaaagugucaaucaugu

 - 40

Get sequence
Deep sequencing845 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).