Stem-loop sequence efu-mir-200b

AccessionMI0028697 (change log)
DescriptionEptesicus fuscus miR-200b stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
   gc    a     ---   -    ug     c      u ugu 
5'   ggcc ucgcc   auc uuac  ggcag auugga g   c
     |||| |||||   ||| ||||  ||||| |||||| |    
3'   ccgg ggcgg   uag aaug  ccguc uaaucu c   a
   uc    -     cag   u    gu     a      - ugg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EptFus1.0; GCA_000308155.1) Overlapping transcripts
JH977681.1: 208041-208120 [+]
intergenic
Clustered miRNAs
< 10kb from efu-mir-200b
efu-mir-200bJH977681.1: 208041-208120 [+]
efu-mir-200aJH977681.1: 208600-208681 [+]
efu-mir-429JH977681.1: 209798-209876 [+]
Database links

Mature sequence efu-miR-200b

Accession MIMAT0035012
Sequence

47 - 

uaauacugccugguaaugaugacg

 - 70

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:24692655 "Large numbers of novel miRNAs originate from DNA transposons and are coincident with a large species radiation in bats" Platt RN 2nd, Vandewege MW, Kern C, Schmidt CJ, Hoffmann FG, Ray DA Mol Biol Evol. 31:1536-1545(2014).