Stem-loop sequence tae-MIR9656

AccessionMI0030373 (change log)
DescriptionTriticum aestivum miR9656 stem-loop
Literature search

1 open access papers mention tae-MIR9656
(1 sentences)

Stem-loop
   ccau   ---u  --gaca      a        u         g a            -cug    u 
5'     ggc    gc      ggcacc uuguucag guuucgaag a auaauaccguug    gguu g
       |||    ||      |||||| |||||||| ||||||||| | ||||||||||||    |||| g
3'     ccg    cg      ccgugg gacaaguc cagagcuuc u uauuauggcaau    ucag a
   ---c   ucau  aagaua      c        u         g c            uuug    g 
Get sequence
Deep sequencing
793031 reads, 3.07e+03 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6D: 169013707-169013836 [-]
intergenic
Database links

Mature sequence tae-miR9656-3p

Accession MIMAT0035763
Sequence

90 - 

cuucgagacucugaacagcgg

 - 110

Get sequence
Deep sequencing747251 reads, 116 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).