Stem-loop sequence tae-MIR9660

AccessionMI0030378 (change log)
DescriptionTriticum aestivum miR9660 stem-loop
Literature search

1 open access papers mention tae-MIR9660
(1 sentences)

Stem-loop
   -           -ug       c   u         uuguuau  aau 
5'  gcucuuucucu   cgagcaa gga gaaucagcc       cc   c
    |||||||||||   ||||||| ||| |||||||||       ||    
3'  ugagaaagaga   gcucguu ccu uuuagucgg       gg   c
   a           uga       u   c         ------u  aga 
Get sequence
Deep sequencing
1449 reads, 0 reads per million, 116 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates Overlapping transcripts
6B: 190032403-190032492 [-]
intergenic
Database links

Mature sequence tae-miR9660-5p

Accession MIMAT0035768
Sequence

11 - 

uugcgagcaacggaugaauc

 - 30

Get sequence
Deep sequencing524 reads, 110 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).