Stem-loop sequence tae-MIR9661

AccessionMI0030380 (change log)
DescriptionTriticum aestivum miR9661 stem-loop
Literature search

2 open access papers mention tae-MIR9661
(3 sentences)

Stem-loop
   -    g             ag    g       -   c 
5'  uugg gaagaugaaguag  cagg accucac gcu a
    |||| |||||||||||||  |||| ||||||| ||| a
3'  aacc cuucuacuucauc  gucc uggagug cga g
   c    a             ca    g       g   a 
Get sequence
Deep sequencing
39 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence tae-miR9661-5p

Accession MIMAT0035770
Sequence

11 - 

ugaaguagagcagggaccuca

 - 31

Get sequence
Deep sequencing20 reads, 18 experiments
Evidence experimental; Illumina [1]

References

1
PMID:24734873 "Identification and characterization of microRNAs in the flag leaf and developing seed of wheat (Triticum aestivum L.)" Han R, Jian C, Lv J, Yan Y, Chi Q, Li Z, Wang Q, Zhang J, Liu X, Zhao H BMC Genomics. 15:289(2014).